Подписаться на новости
  • Сенатор
  • ООО "Ай Вао"
  • Vitacoin

Сыновья Адама: гены, история и география

Генография: извилистый путь вокруг света

Вопрос «откуда есть пошла» для целых племен и народов до недавнего времени решался с помощью данных истории, археологии, лингвистики и других не очень точных наук. Определить свою личную родословную любой человек мог с помощью архивов ЗАГСов, ревизских сказок, церковноприходских книг и т.п. – на 3, 5, хорошо если на 10-15 поколений – кроме потомственных аристократов, включая тех, кто ведет свой род от Рюрика, который «придоша княжить и володеть нами» в 862 г., или от Али, племянника пророка Мухаммеда (602-661 гг.). Но «когда Адам пахал, а Ева пряла, где был тогда господин?»

Сейчас любой из нас может определить свою родословную до прародителей человечества. Правда, не библейских, а молекулярно-генетических – «митохондриальной Евы» и « Y-хромосомного Адама». К ним, жившим в Юго-Восточной Африке (по самым общепринятым из условных и приблизительных оценок – 150-170 и 60-80 тысяч лет назад), сходятся ветви генеалогического древа каждого из живущих сейчас на Земле 6,6 миллиардов человек. За прошедшие тысячелетия в нашей ДНК к записям о родстве с ними, как визы в паспорте, добавились пометки о путях, по которым потомки Адама и Евы разбрелись по миру.

Эволюция человека и его родственников, включая наших кузенов-неандертальцев (похоже, что совместно нажитые дети у нас если и были, то их потомки вымерли, не оставив никаких следов в геноме современного человека) – тема интересная, но отдельная. Начнем сразу с «конца начала» – с того, что примерно 200 000 лет назад в Африке сформировался практически современный подвид вида «человек разумный», а около 50 000 лет назад племена наших предков начали расселяться за пределы Африки.

Анализ ДНК может ответить на множество вопросов. Какой народ каким путем добрался до нынешнего места жительства за тысячелетия великих и незаметных переселений, завоеваний, объединений и расколов? Как за это время перемешались расы и племена? Как носило по свету лично ваших предков с тех пор, как десятки тысяч лет назад они покинули колыбель народов – Африку? И от какой из групп этих переселенцев вы происходите – отдельно по отцовской и материнской линии? Сколько поколений назад жил ближайший предок, от которого по прямой линии произошли лично вы и кто-нибудь из ныне царствующих особ? Не приходится ли вам близким родственником рядовой гражданин, живущий на другом континенте или на соседней улице?

Изучать этногеномику начали еще в 1980-х годах, когда большие компьютеры еще доживали свой век, а методы анализа ДНК были на несколько порядков медленнее и дороже нынешних. Сейчас самый простой, но достаточно полный анализ индивидуальной молекулярной генеалогии, по 12 маркерам Y-хромосомы, стоит $100-150, а более чем достаточный, по 37 маркерам Y-ДНК + полный тест митохондриальной ДНК – около 400. Базы данных на десятки тысяч образцов ДНК есть у ряда коммерческих фирм и общественных институтов, и большинство из них (с определенными ограничениями на допуск к персональной информации) являются открытыми. За счет интереса людей к своим родословным информация в этих базах накапливается быстрее, чем ученые успевают ее обработать – тем более что плановых научных работ никто не отменял. Самое грандиозное из таких исследований – начатый в 2005 г. проект «Генография». Главное требование к участникам проекта – принадлежность к народу или племени, история которых известна по данным этнографии и лингвистики, знание не менее четырех поколений своих предков, живших в этом же регионе, и мужской пол. (Никакого сексизма, просто у мужчин в одной пробе – соскобе с внутренней стороны щеки – можно получить и Y-хромосому, и митохондриальную ДНК.)

Цель проекта – за пять лет собрать не менее 100 000 образцов ДНК, чтобы уточнить пути миграций человечества по Земле. На самом деле и такая огромная выборка – капля в море по сравнению с реальным разнообразием рас и племен, но по мере добавления информации результаты можно будет уточнять. Хотя даже черновой план, составленный участниками проекта под руководством доктора Спенсера Уэллса – захватывающее зрелище, особенно в виде интерактивной карты на сайте National Geographic, с подробными комментариями и массой дополнительной информации. Но чтобы понять, что там написано (к тому же по-английски), придется разобраться с терминами.

Генетический ликбез

В ядре каждой человеческой клетки, кроме яйцеклеток и сперматозоидов, содержится диплоидный (двойной) набор из 46 хромосом: 22 пары соматических («телесных») и пара половых: XX у женщин и XY у мужчин. В половых клетках набор хромосом гаплоидный – одиночный (без греческих терминов тут не обойтись: хромосомная генеалогия основана на определении индивидуальных гаплотипов , относящихся к разным гаплогруппам).

При образовании половых клеток из диплоидных клеток-предшественников их соматические хромосомы (а у женщин – и половые) обмениваются участками – примерно так, как происходит, если не слишком тщательно перетасовать две колоды карт с рубашками разного цвета и снова разложить их на два одинаковых набора независимо от цвета рубашек. По четверти генома мы получаем от каждого из двух дедушек и двух бабушек, 1/8 – от прадедов и прабабок...

В наших хромосомах есть гены не только Адама и Евы, но и всех их близких и дальних родственников, живших 70-80 000 лет назад, когда численность нашего вида снизилась до критической величины – примерно 10 000 особей, и более далеких предков, вплоть до первых млекопитающих и даже первых многоклеточных животных. Но от них мы получили только соматические и X -хромосомы, гены которых в результате постоянного перемешивания расплываются по всей популяции. Почти неизменными из поколения в поколение переходят Y-хромосома и митохондриальная ДНК. На этом «почти» и основана молекулярная генеалогия, изучающая историю по мутациям, произошедшим у предков и сохранившимся в ДНК потомков.

Обычно крупные мутации – например, перемещение на другое место, удвоение или, наоборот, выпадение крупного участка хромосомы, несущего один или несколько генов – не приводят ни к чему хорошему. Как, впрочем, и часто встречающиеся одиночные нуклеотидные полиморфизмы – single nucleotide polymorphism, SNP (произносится как «снип»), если они происходят в пределах одного из 21 000 человеческих генов. (Аббревиатуры SNP, а также STR и DYS , о которых речь пойдет позже, тоже придётся запомнить: без них в молекулярной генеалогии – как без рук.)

Полезные мутации происходят намного реже и сохраняются в последующих поколениях. Вредные – удаляются из популяции вместе с носителем, или еще на стадии эмбриона, или, при тяжелой наследственной болезни, до того, как этот носитель успеет обзавестись потомством. В результате действия стабилизирующего отбора и происходивших время от времени снижений численности вида, уменьшающих его генетическое разнообразие, строение генов у двух выбранных наугад людей совпадает на 99,9%. Все наши отличия, от цвета кожи и разреза глаз до роста и склонности к определенным болезням, определяют в основном генные полиморфизмы – незначительные различия в нуклеотидных последовательностях практически одинаковых генов и, соответственно, в строении и функциях закодированных в этих генах белков.

Случайные мутации происходят постоянно, и полиморфизмами считают те из них, которые, во-первых, произошли давно и поэтому встречаются чаще, чем у 1% людей в данной популяции (граница здесь условная – можно было бы считать случайными и варианты генов, встречающиеся реже, чем у 2 или 3%). Во-вторых, полиморфизмы не оказывают заметного влияния на здоровье их носителей или даже носят приспособительный характер. Правда, и здесь граница довольно размытая. Классический пример – SNP, из-за которого в результате замены одной аминокислоты β-субъединица молекулы гемоглобина становится неполноценной. Эта мутация встречается на юге Индии, в Средиземноморье и у жителей Западной Африки и их потомков на других континентах. Гетерозиготы по этому гену – носители здорового варианта на одной хромосоме и «испорченного» на другой – реже болеют малярией, а симптомы анемии испытывают только в экстремальных условиях, например, в высокогорье. У гомозигот по мутантному гену развивается тяжелая болезнь – серповидноклеточная анемия.

SNP – явление довольно частое: при копировании хромосом они происходят с вероятностью 10–8 на один нуклеотид за поколение. При размере гаплоидного генома в 3 миллиарда (3×109 ) нуклеотидов за счет случайных точечных мутаций каждый ребенок имеет в среднем около 30 однонуклеотидных различий со своими родителями. По счастью, большинство таких мутаций приходится не на гены, а на так называемую «мусорную ДНК» – примерно 95% человеческого генома, не кодирующих ни белков, ни служебных РНК. Эти мутации ни на что не влияют, отбору они безразличны – вот они и сохраняются среди остального генетического мусора. Их, а также короткие тандемные повторы (о них мы поговорим позже), и используют в молекулярной генеалогии в качестве хромосомных мАркеров – характерных особенностей.

Генетическая колода тасуется при рождении каждого ребенка, так что по м а ркерам соматических хромосом свою родословную определить можно, но сложно и весьма приблизительно. Например, чтобы с почти стопроцентной точностью определить расовую принадлежность человека, и то – для типичных представителей этой расы, необходимо проанализировать несколько сотен соматических ДНК-маркеров. По нескольким тысячам можно установить, из какого региона происходит обладатель генома – с точностью до «Юго-Восточная Азия» или «Северная Европа», причем в зонах контакта разных рас и племен – между Волгой и Уралом или в обеих Америках – это сделать практически невозможно из-за смешения генофондов. А по маркерам митохондриальной ДНК и Y -хромосомы определить свою родословную можно очень точно.

Начнем с Адама: с мужской молекулярной генеалогией разобраться немного проще. И добавим сразу: все сказанное ниже о своем происхождении по мужской линии могут узнать и дамы. Для этого нужно всего лишь проанализировать ДНК отца (или брата, или дяди – любого прямого родственника по отцу).

Чем мальчики отличаются от девочек

Примерно 300 миллионов лет назад, у первых млекопитающих, одна из хромосом, несущая среди прочих несколько генов, определяющих принадлежность к мужскому полу, начала терять остальные гены и вместе с ними – способность обмениваться участками ДНК с парной хромосомой. У человека на Y-хромосоме осталось всего 27 генов, большинство из которых работают только в семенниках. Остальная часть Y-хромосомной ДНК может пригодиться разве что для этнографии и генеалогии – зато и годится для этих целей она намного лучше, чем соматические хромосомы. Мутации – выпадения, замены или добавления одиночных нуклеотидов (SNP) и изменения числа повторений трех-четырех одинаковых нуклеотидов, так называемые короткие тандемные повторы, Short Tandem Repeat (STR) – происходят в разных участках Y-хромосомы с разной частотой, в среднем – одна мутация на каждые 500 поколений. В самых консервативных участках мутации случаются раз в 100 000 лет. ( Y-хромосомный Адам жил примерно 80 000 лет назад, но «раз в 100 000 лет» – это вероятность мутации в этом участке хромосомы в непрерывном ряду поколений, и можно подсчитать, что даже такой редкий случай может произойти один раз в поколение примерно у одной из 3 000 пар «отец-сын»). Время и место жизни нашего общего прямого предка вычислили по анализу распределения в популяциях из разных регионов планеты Y -хромосомных маркеров. Их используют и для исследований в области этногеномики, и для выяснения индивидуальных генеалогий – в качестве молекулярных штампов о регистрации и свидетельств о рождении.

Молекулярная генеалогия крупным планом

Общепринятая классификация линий Y-хромосомы основана на последовательности появления на ней SNP-маркеров. На генеалогическом древе современных мужчин выделено 18 основных ветвей, обозначенных латинскими буквами, от первой ветки у самого корня – А, до самой поздней – R. Эта классификация учитывает примерно 250 маркеров, по которым сейчас выделяют около 170 конечных кластеров, каждый – со своим набором последовательно происходивших мутаций. Такая номенклатура позволяет по мере выявления новых маркеров добавлять к схеме новые ветви, не меняя общую топологию древа.

Пытаться пересказать условные коды всех маркеров и последовательность их появления для каждой из основных гаплогрупп и всё более дробных подгрупп – дело безнадежное: каждая из современных ветвей молекулярно-генеалогического древа отличается от Адама примерно двумя десятками разных мутаций в разных участках Y-хромосомы. Где именно они находятся и что в них происходило – выпадение одного нуклеотида, замена другого, выпадение третьего или рекуррентная (восстановительная) мутация, по случайному совпадению вернувшая потерянный гуанин на старое место (из-за этого у «славянской» подгруппы R1a1 самый древний маркер пришел в тот же вид, каким он был у Адама) – тем более оставим специалистам. Хотя многие энтузиасты-любители (например, на форуме сайта «ДНК-древо») неплохо разбираются и в таких тонкостях.

В истории и географии разобраться проще. Например, у населения старинных русских городов чаще всего встречаются гаплогруппы R1a, I1b и N. Очень условно их носителей можно назвать соответственно потомками восточных, южных и северных славян. На самом деле мутация, определяющая принадлежность к ветви R, предположительно появилась на северо-западе Азии 30-35000 лет назад: в племени, все мужчины которого (или большинство из них) относились к более ранней гаплогруппе P, родился мальчик, в Y-хромосоме которого произошел сбой – замена всего одного нуклеотида, аденина на гуанин. Его потомки расселились по Европе и западной части Азии, по дороге смешиваясь с местными племенами, но у всех его прямых наследников сохранилась эта метка – маркер M207. Ее нашли и у мужчин одного из изолированных племен Камеруна – скорее всего, это потомки части доисторического племени, которая вернулась из Евразии в Африку. У кого-то из пра-пра…правнуков родоначальника гаплогруппы R, двигавшихся понемногу на юг, 25 000 лет назад произошла еще одна мутация, M127 – ее носители, представители гаплогруппы R2, составляют 5-10% населения юга Центральной Азии, Пакистана и северной Индии. Еще одна ветвь этой группы повернула на запад, на земли, с которых сползал последний ледник. Подгруппа R1, у которой к предыдущим меткам на Y-хромосоме примерно 30 000 лет назад добавилась мутация M173, – самая распространенная в Европе и западной Евразии. Подгруппа R1a (M17) зародилась в степях на территории нынешней Украины и юга России 10-15 000 лет назад. Племена известной по археологическим данным курганной культуры одними из первых приручили лошадь и за счет этого расселились чуть ли не по всему континенту, покорили туземцев, перемешались с ними и навязали им свой язык и религию, ставшие основой протоиндоевропейской (индоарийской) культуры. К прямым потомкам индоариев относятся 45% мужчин в высших кастах Индии, 40% поляков, северных русских, украинцев, белорусов, латышей и литовцев. Немного реже она встречается у южных и западных славян, исландцев (Рюрик тоже был викингом), восточных немцев и народов России, язык которых относится к угро-финской группе (тысячелетия соседства давно перемешали «русь, мордву и чудь»). Несмотря на все последующие смешения племен, носители подгруппы R1a в южнорусских городах составляют 55% мужского населения, а в центральной России – до 70%. Но если кто-нибудь решит на основании принадлежности к этой подгруппе гордиться своей арийской кровью, напоминаем: ваши родственники живут и в пустыне Калахари, и далее по глобусу до Гренландии, Австралии и Огненной Земли. И проверьте свое происхождение по материнской линии, по митохондриальной ДНК, а потом – по соматическим маркерам. Кстати, среди казахов – во всём остальном типичных монголоидов – носителей подгруппы R1a не меньше, чем в России. Да, скифы мы…

Этногеномика имеет дело с вероятностями мутаций, полученными путем приблизительных подсчетов, выборками из популяций и другими среднестатистическими величинами. Даже число тысячелетий в этих расчетах зависит от того, какое время смены поколений, от 20 до 35 лет, выберут авторы работы. Максимальное приближение во времени, которое показывает гаплогруппа, даже с самым длинным буквенно-цифровым индексом, – это вероятность появления одного SNP , в лучшем случае 5 000 лет, так что деталей индивидуальной генеалогии по ней не определить. Можно разве что спорить, родственниками в двухсотом или трехсотом колене приходятся друг другу больше трети жителей северной Индии, почти половина русских и почти треть норвежцев.

Вот как выглядят верхушки переплетенных ветвей Y -хромосомного древа при взгляде с орбиты – без тонких деталей в виде подгрупп

Молекулярная генеалогия с точностью до…

Для детальных исследований в молекулярной генеалогии применяют короткие тандемные повторы (STR). Среди прочей абракадабры в ДНК время от времени встречаются бессмысленные повторения трех-четырех нуклеотидов, например, таких: TAGATAGATAGATAGATAGATAGATAGA… – тимин-аденин-гуанин-аденин. Любитель ДНК-родословных легко узнает в этих буквах первый из наиболее часто используемых маркеров Y -хромосомы, DYS19 (DNA Y-chromosome Segment № 19). При образовании сперматозоидов ферменты, копирующие ДНК клетки-предшественника, иногда пропускают или добавляют к такому тандему один из повторов. Если этот сперматозоид примет участие в рождении мальчика, все его сыновья, внуки и правнуки сохранят новую запись в этом маркере до тех пор, пока прямой род по мужской линии не оборвется – или до следующей мутации в том же STR. Повторная мутация может увеличить разницу в большую или меньшую сторону, сделав различия между ветвями древа более четкими, а может и восстановить исходное состояние. Но при использовании большого числа маркеров степень родства можно установить достаточно точно.

У всех мужчин на Земле в локусах DYS19, 388, 390, 391, 392 и 393 есть тандемные повторы разной длины. Например, квадруплет TAGA (DYS19) может повторяться от 10 до 19 раз, триплет АТА (DYS388) – 10-16 раз и т.д. У 98% мужчин к базовому набору из шести общих маркеров, унаследованных от хромосомного Адама, добавился DYS385 – от 7 до 28 повторов «GAAA». У 34% есть еще DYS438 и 439, и т.д. В качестве генеалогических маркеров выбраны самые информативные из почти пятисот обнаруженных на Y-хромосоме STR. Стандартные ДНК-генеалогические тесты проводят по 12, 25, 37 или 67 маркерам, хотя уже шести часто достаточно для того, чтобы по комбинации числа повторов отнести «владельца» этого гаплотипа (индивидуального набора маркеров) к одной из гаплогрупп, от A до R . Например, так называемый «атлантический модальный гаплотип», наиболее распространенный на западе Европы, выглядит так: DYS19=14, DYS388=12, DYS390=24, DYS39=11, DYS392=13, DYS393=13. Человек с таким гаплотипом практически со стопроцентной точностью относится к гаплогруппе R1b или ее подвариантам.

 

Чем меньше расхождений в числе повторов нуклеотидных групп во всех проанализированных DYS ах между двумя гаплотипами, тем больше вероятность того, что их носители – родственники или однофамильцы (и тоже родственники, только более дальние). В тесте по 37 маркерам вероятность случайного совпадения всех из них – 1/637, 1 шанс из 6×1028 (население Земли, напомним, 6,6×109).

Даже по 12 маркерам вероятность случайного совпадения – 1 шанс из двух с лишним миллиардов, и при полном совпадении чьих-нибудь DYS с вашим гаплотипом можно быть уверенным, что вы нашли брата, отца, дядю или «многоюродного» (но не более чем в десятом-пятнадцатом колене) родственника по прямой мужской линии.

Пару лет назад именно таким способом нашел своего отца американский подросток, зачатый «в пробирке» с помощью спермы анонимного донора. Правда, в базе данных оказалось двое мужчин с одинаковыми фамилиями. (Ничего удивительного: средняя вероятность при определении фамилии по ДНК, например, в Англии с ее обширными базами данных – 34%. Для Смитов и Браунов этот метод не подходит, а носителей более редких фамилий можно вычислить достаточно точно и, если это ДНК с места преступления, сузить круг подозреваемых.)

Со слов матери мальчик знал время и место рождения донора, влез в другую базу, нашел имена всех мужчин, которые родились в нужном месте в подходящее время и выяснил, кто из двоих – его биологический папаша. Встретились они или нет и были ли рады такой находке – об этом история умалчивает.

А что может быть в случае, если в такой базе вы найдете последовательность чисел, отличающуюся от вашей на 1, 2 или 5 единиц? Можно прикинуть, сколько поколений назад жил ваш ближайший общий предок. Расхождение на один повтор в любом из маркеров происходит в среднем один раз в 500 поколений, примерно раз в 15 000 лет. В гаплотипе из 37 маркеров одна мутация может произойти примерно раз в 13 поколений, или в 300- 400 лет. И средние частоты мутаций в каждом из DYS подсчитаны – можно еще немного уточнить возможное время расхождения. Правда, всё равно это будет всего лишь вероятность, но дальше уже можно будет покопаться в бумажных данных, от семейных архивов до летописей. И в любом случае вы узнаете много интересного, особенно если к информации об Y -хромосоме добавить анализ митохондриальной ДНК. Но о родстве по материнской линии читайте в следующей статье (Дочери Евы: гены, история и география).

Благодарим Анатолия Клесова за помощь в написании статьи.

Александр Чубенко
Портал «Вечная молодость»  www.vechnayamolodost.ru

Журнальный вариант статьи опубликован в «Популярной механике» №10-2007

29.10.2007

Читать статьи по темам:

геномика мутация снипы хромосомы эволюция человека Версия для печати
Ошибка в тексте?
Выдели ее и нажми ctrl + enter
назад

Читать также:

Где больше всего мутантов?

Сразу несколько исследовательских групп пытаются определить, геномы какой из человеческих рас содержат больше мутаций и насколько эти мутации опасны для её представителей.

читать

Горячие точки современной геронтологии

Рост продолжительности жизни и старение населения развитых стран усилили интерес к геронтологии, и прежде всего – к изучению первичных механизмов старения организмов и популяций, а также факторов, определяющих продолжительность жизни.

читать

Марио Капеччи: особенности индивидуального подхода

Марио Капеччи сделал фантастическую академическую карьеру. Сегодня метод нокаута, одним из отцов которого был Капеччи, – уже классика молекулярной биологии.

читать

Похвальное слово персонализированной медицине (2)

Персонализированная медицина предоставляет новую, более выгодную как для фармакологических компаний, так и для пациентов, экономическую модель разработки препаратов.

читать

Похвальное слово персонализированной медицине (1)

За счет использования молекулярно-генетического анализа для достижения оптимальных медицинских результатов в борьбе с болезнью или предрасположенностью пациента к тому или иному заболеванию, персонализированная медицина может привести к внедрению новых стандартов здравоохранения.

читать